Top » Catalog » SNPs » FGC44085

$18.00

FGC44085
[FGC44085]

FGC44085
hg38 Position: ChrY:13557436..13557436
Ancestral: G
Derived: T
Reference: Full Genomes (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC44085_F CAAATGAAAGATATAACTATAGGGTCTTCC
Reverse Primer: FGC44085_R GCATAGTTACGGGCATGGAC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies