Top » Catalog » SNPs » FGC45647

$18.00

FGC45647
[FGC45647]

FGC45647
hg38 Position: ChrY:19122213..19122213
Ancestral: G
Derived: C
Reference: Full Genomes (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC45647_F CAGATATCATTATGAAACCACCTGTAG
Reverse Primer: FGC45647_R GCTGGTCTTGAATTCCTTGC
Reviews

Customers who bought this product also purchased
FGC19306
FGC19306
FGC14566
FGC14566
FGC45646
FGC45646
FGC14564
FGC14564
FGC44086
FGC44086
FGC14559
FGC14559
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies