Top » Catalog » SNPs » FGC45647

$18.00

FGC45647
[FGC45647]

FGC45647
hg38 Position: ChrY:19122213..19122213
Ancestral: G
Derived: C
Reference: Full Genomes (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC45647_F CAGATATCATTATGAAACCACCTGTAG
Reverse Primer: FGC45647_R GCTGGTCTTGAATTCCTTGC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies