Top » Catalog » SNPs » FGC33265

$18.00

FGC33265
[FGC33265]

FGC33265
hg38 Position: ChrY:8066143..8066143
Ancestral: A
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33265_F GTGGGAATGTGATATCTACCTAGATG
Reverse Primer: FGC33265_R TAGGTGATAGGCCCTGAGACC
Reviews

Customers who bought this product also purchased
FGC23334
FGC23334
FGC23339
FGC23339
FGC19432
FGC19432
FGC23333
FGC23333
FGC23338
FGC23338
FGC17906
FGC17906
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies