Top » Catalog » SNPs » FGC33265

$18.00

FGC33265
[FGC33265]

FGC33265
hg38 Position: ChrY:8066143..8066143
Ancestral: A
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33265_F GTGGGAATGTGATATCTACCTAGATG
Reverse Primer: FGC33265_R TAGGTGATAGGCCCTGAGACC
Reviews

Customers who bought this product also purchased
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
FGC39789
FGC39789
FGC23331
FGC23331
FGC23336
FGC23336
FGC39788
FGC39788
FGC23330
FGC23330
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies