Top » Catalog » SNPs » FGC33267

$18.00

FGC33267
[FGC33267]

FGC33267
hg38 Position: ChrY:13836466..13836466
Ancestral: A
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33267_F GGCAGCCAGAGATTCTAGATTAAG
Reverse Primer: FGC33267_R GAAGTGAACACATGGCACTCC
Reviews

Customers who bought this product also purchased
FGC23330
FGC23330
FGC23335
FGC23335
FGC39790
FGC39790
FGC19434
FGC19434
FGC23334
FGC23334
FGC23339
FGC23339
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies