Top » Catalog » SNPs » FGC33267

$18.00

FGC33267
[FGC33267]

FGC33267
hg38 Position: ChrY:13836466..13836466
Ancestral: A
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33267_F GGCAGCCAGAGATTCTAGATTAAG
Reverse Primer: FGC33267_R GAAGTGAACACATGGCACTCC
Reviews

Customers who bought this product also purchased
FGC23333
FGC23333
FGC23338
FGC23338
FGC17906
FGC17906
FGC33265
FGC33265
FGC23332
FGC23332
FGC23337
FGC23337
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies