Top » Catalog » SNPs » A10959

$18.00

A10959
[A10959]

A10959
hg38 Position: ChrY:14602694..14602694
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2a
Comments: Downstream CTS10228 > A2512
Forward Primer: A10959_F CCTCAGGATTCGGTTTTCAG
Reverse Primer: A10959_R TTCTCCACCCACATGTGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies