Top » Catalog » SNPs » Y2194

$18.00

Y2194
[Y2194]

Y2194
hg38 Position: ChrY:13055163..13055163
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Found from public sources
Forward Primer: Y2194_F CCTAGCAGAACTGGGACGTG
Reverse Primer: Y2194_R GGTGGTGGACCTACATCAGG
Reviews

Customers who bought this product also purchased
Y33
Y33
BY27373
BY27373
YP237
YP237
YP3929
YP3929
Y35
Y35
YP1626
YP1626
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies