Top » Catalog » SNPs » Y2194

$18.00

Y2194
[Y2194]

Y2194
hg38 Position: ChrY:13055163..13055163
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Found from public sources
Forward Primer: Y2194_F CCTAGCAGAACTGGGACGTG
Reverse Primer: Y2194_R GGTGGTGGACCTACATCAGG
Reviews

Customers who bought this product also purchased
YP613
YP613
Y2608
Y2608
YP6098
YP6098
Y33
Y33
BY27373
BY27373
YP237
YP237
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies