Top » Catalog » SNPs » Y2194

$18.00

Y2194
[Y2194]

Y2194
hg38 Position: ChrY:13055163..13055163
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Found from public sources
Forward Primer: Y2194_F CCTAGCAGAACTGGGACGTG
Reverse Primer: Y2194_R GGTGGTGGACCTACATCAGG
Reviews

Customers who bought this product also purchased
YP237
YP237
YP3929
YP3929
Y35
Y35
YP1626
YP1626
R1a-Z280 Panel
R1a-Z280 Panel
YP613
YP613
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies