Top » Catalog » SNPs » Y2613

$18.00

Y2613
[Y2613]

Y2613
hg38 Position: ChrY:14734758..14734758
Ancestral: A
Derived: G
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b1a (not listed)
Comments: Found from public sources
Forward Primer: Y2613_F CCATAATTTCCCTGCCTCTG
Reverse Primer: Y2613_R AAATCAGCTACTGGCTTTTTGC
Reviews

Customers who bought this product also purchased
R1a-Z93 Panel
R1a-Z93 Panel
Y2395
Y2395
Z93
Z93
YP1506
YP1506
Y41337
Y41337
YP5585
YP5585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies