Top » Catalog » SNPs » FGC6782

$18.00

FGC6782
[FGC6782]

FGC6782
hg38 Position: ChrY:8288182..8288183
Ancestral: del
Derived: ins
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y2318. Upstream of FGC2
Forward Primer: FGC6782_F TTTTTATTGTGGCAGAATGCAC
Reverse Primer: FGC6782_R GGACAAGGGGAGTGAACTTAAAC
Reviews

Customers who bought this product also purchased
ZS8177
ZS8177
S782
S782
FGC5424
FGC5424
FGC5418
FGC5418
FGC1707
FGC1707
FGC47354
FGC47354
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies