Top » Catalog » SNPs » FGC6782

$18.00

FGC6782
[FGC6782]

FGC6782
HG19 Position: ChrY:8156223..8156224
Ancestral: del
Derived: ins
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y2318. Below FGC2
Forward Primer: FGC6782_F TTTTTATTGTGGCAGAATGCAC
Reverse Primer: FGC6782_R GGACAAGGGGAGTGAACTTAAAC
Reviews

Customers who bought this product also purchased
ZS8177
ZS8177
S782
S782
FGC5424
FGC5424
ZS5205
ZS5205
FGC33172
FGC33172
FGC5432
FGC5432
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies