Top » Catalog » SNPs » FGC22844

$18.00

FGC22844
[FGC22844]

FGC22844
hg38 Position: ChrY:17444806..17444806
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: E1b (not listed)
Comments: .
Forward Primer: FGC22844_F GCTTGGAGAAGTTTGTTTTACCC
Reverse Primer: FGC22844_R TGGTGATACCCAGTCAAACCA
Reviews

Customers who bought this product also purchased
PF2548
PF2548
BY9954
BY9954
MZ149
MZ149
Y101404
Y101404
MZ19
MZ19
MZ89
MZ89
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies