Top » Catalog » SNPs » FGC3723

$18.00

FGC3723
[FGC3723]

FGC3723
hg38 Position: ChrY:15926762..15926762
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC3723_F CCATTAACTAAGCTTTGAGCCAC
Reverse Primer: FGC3723_R CTGTGGGGAGTCTGTGCTTC
Reviews

Customers who bought this product also purchased
Y4348
Y4348
FGC19543
FGC19543
B237
B237
FGC54321
FGC54321
CTS10177
CTS10177
ZS9734
ZS9734
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies