Top » Catalog » SNPs » FGC3723

$18.00

FGC3723
[FGC3723]

FGC3723
hg38 Position: ChrY:15926762..15926762
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC3723_F CCATTAACTAAGCTTTGAGCCAC
Reverse Primer: FGC3723_R CTGTGGGGAGTCTGTGCTTC
Reviews

Customers who bought this product also purchased
FGC29883
FGC29883
FGC4474
FGC4474
FGC2
FGC2
FGC5427
FGC5427
ZS4491
ZS4491
ZS5509
ZS5509
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies