Top » Catalog » SNPs » Z640

$18.00

Z640
[Z640]

Z640
hg38 Position: ChrY:8342439..8342439
Ancestral: T
Derived: G
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J1
Comments: Equivalent to or downstream from L147
Forward Primer: Z640_F CTTGATTACAAGGAGATTGTGAAATTC
Reverse Primer: Z640_R CATCTTGCACATGTTCTGGG
Reviews

Customers who bought this product also purchased
DYS393
DYS393
YSEQ-Alpha
YSEQ-Alpha
ZS4020
ZS4020
ZS6067
ZS6067
Z18215
Z18215
ZS5597
ZS5597
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18435
$18.00
Haplogroup Info
Other products
Currencies