Top » Catalog » SNPs » Z640

$19.00

Z640
[Z640]

Z640
hg38 Position: ChrY:8342439..8342439
Ancestral: T
Derived: G
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J1
Comments: Equivalent to or downstream from L147
Forward Primer: Z640_F CTTGATTACAAGGAGATTGTGAAATTC
Reverse Primer: Z640_R CATCTTGCACATGTTCTGGG
Reviews (1)

Customers who bought this product also purchased
FT382855
FT382855
FTC74642
FTC74642
FGC67976
FGC67976
A28713
A28713
FGC75054
FGC75054
Y110737
Y110737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies