Top » Catalog » SNPs » Z640

$15.00

Z640
[Z640]

Z640
hg38 Position: ChrY:8342439..8342439
Ancestral: T
Derived: G
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J1
Comments: Equivalent to or downstream from L147
Forward Primer: Z640_F CTTGATTACAAGGAGATTGTGAAATTC
Reverse Primer: Z640_R CATCTTGCACATGTTCTGGG
Reviews

Customers who bought this product also purchased
S13122
S13122
L829
L829
ZS1482
ZS1482
ZS1431
ZS1431
BY162752
BY162752
BY74
BY74
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies