Top » Catalog » SNPs » Z640

$18.00

Z640
[Z640]

Z640
hg38 Position: ChrY:8342439..8342439
Ancestral: T
Derived: G
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J1
Comments: Equivalent to or downstream from L147
Forward Primer: Z640_F CTTGATTACAAGGAGATTGTGAAATTC
Reverse Primer: Z640_R CATCTTGCACATGTTCTGGG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Y4348
Y4348
Z18257
Z18257
FGC3722
FGC3722
FGC19543
FGC19543
ZS3844
ZS3844
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies