Top » Catalog » SNPs » Z644

$18.00

Z644
[Z644]

Z644
hg38 Position: ChrY:22230816..22230816
Ancestral: G
Derived: A
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J1
Comments: Equivalent to or downstream from L147
Forward Primer: Z644_F GGATCTTTTATGCATGCAGC
Reverse Primer: Z644_R TAAAGGTAGTCCTCACATTCATGC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
FGC1723
FGC1723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies