Top » Catalog » SNPs » FGC4474

$18.00

FGC4474
[FGC4474]

FGC4474
hg38 Position: ChrY:8724043..8724043
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC4
Comments: Downstream of J1-FGC4
Forward Primer: FGC4474vl_F ATTCAAGAGCCCCTGTGGAG
Reverse Primer: FGC4474vl_R CAGCTCTGATAGTCAGGTACCCTG
Reviews

Customers who bought this product also purchased
FGC45019
FGC45019
FGC60202
FGC60202
FGC5451
FGC5451
ZS10480
ZS10480
FGC5454
FGC5454
FT105587
FT105587
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies