Top » Catalog » SNPs » FGC4474

$19.00

FGC4474
[FGC4474]

FGC4474
hg38 Position: ChrY:8724043..8724043
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC4
Comments: Downstream of J1-FGC4
Forward Primer: FGC4474vl_F ATTCAAGAGCCCCTGTGGAG
Reverse Primer: FGC4474vl_R CAGCTCTGATAGTCAGGTACCCTG
Reviews

Customers who bought this product also purchased
FT36360
FT36360
FTB22281
FTB22281
ZS11277
ZS11277
FT197214
FT197214
FT36465
FT36465
FT102480
FT102480
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies