Top » Catalog » SNPs » FGC5419

$18.00

FGC5419
[FGC5419]

FGC5419
hg38 Position: ChrY:7141244..7141244
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5419_F GGAGCCAGAGTCTCACTCTGTC
Reverse Primer: FGC5419_R AACATCATCTGGCTACCACATG
Reviews

Customers who bought this product also purchased
FGC22257
FGC22257
FGC5418
FGC5418
YSC0001343
YSC0001343
ZS8177
ZS8177
FGC41256
FGC41256
FGC1721
FGC1721
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies