Top » Catalog » SNPs » FGC5419

$18.00

FGC5419
[FGC5419]

FGC5419
HG19 Position: ChrY:7141244..7141244
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5419_F GGAGCCAGAGTCTCACTCTGTC
Reverse Primer: FGC5419_R AACATCATCTGGCTACCACATG
Reviews

Customers who bought this product also purchased
FGC4474
FGC4474
FGC11
FGC11
ZS5010
ZS5010
FGC1
FGC1
Z18219
Z18219
FGC22257
FGC22257
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies