Top » Catalog » SNPs » FGC5419

$18.00

FGC5419
[FGC5419]

FGC5419
hg38 Position: ChrY:7141244..7141244
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5419_F GGAGCCAGAGTCTCACTCTGTC
Reverse Primer: FGC5419_R AACATCATCTGGCTACCACATG
Reviews

Customers who bought this product also purchased
FGC48180
FGC48180
FGC22257
FGC22257
YSC0001343
YSC0001343
FGC5418
FGC5418
ZS8177
ZS8177
FGC29811
FGC29811
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies