Top » Catalog » SNPs » FGC5424

$18.00

FGC5424
[FGC5424]

FGC5424
hg38 Position: ChrY:12013927..12013927
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5424_F GCACTCTCTGTATTTCCCAAATG
Reverse Primer: FGC5424_R GCACATGTACCCTAAAACTTAACG
Reviews

Customers who bought this product also purchased
FGC60667
FGC60667
Y22049
Y22049
Z18220
Z18220
ZS6416
ZS6416
BY37871
BY37871
FGC23317
FGC23317
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies