Top » Catalog » SNPs » FGC5441

$18.00

FGC5441
[FGC5441]

FGC5441
hg38 Position: ChrY:3023312..3023312
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Below FGC1
Forward Primer: FGC5441_F TCCCTCTGAAGACCTGGTAGG
Reverse Primer: FGC5441_R CTCCCTAGCCCTCCGTAAAC
Reviews

Customers who bought this product also purchased
FGC45682
FGC45682
FGC93790
FGC93790
FGC76888
FGC76888
HU683
HU683
BY119177
BY119177
FT126929
FT126929
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies