Top » Catalog » SNPs » FGC6770

$18.00

FGC6770
[FGC6770]

FGC6770
HG19 Position: ChrY:6799189..6799189
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC2 > FGC8091
Forward Primer: FGC6770_F TTGGACCTGAGAAACAGAAGG
Reverse Primer: FGC6770_R GATGGGAGAATCGTCTGAGC
Reviews

Customers who bought this product also purchased
ZS7564
ZS7564
ZS7091
ZS7091
FGC4480
FGC4480
ZS12046
ZS12046
FGC5419
FGC5419
FGC7
FGC7
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies