Top » Catalog » SNPs » S782

$18.00

S782
[S782]

S782
hg38 Position: ChrY:16813434..16813434
Ancestral: T
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: S782_F CAGTTGCAAACCAATTAAACTCC
Reverse Primer: S782_R ACAAGTACAGGCCGGAAATG
Reviews

Customers who bought this product also purchased
YFS4293920
YFS4293920
YSEQ-Gamma
YSEQ-Gamma
YFS4293919
YFS4293919
YSEQ-Delta
YSEQ-Delta
FGC68209
FGC68209
YFS4293978
YFS4293978
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies