Top » Catalog » SNPs » S782

$18.00

S782
[S782]

S782
hg38 Position: ChrY:16813434..16813434
Ancestral: T
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: S782_F CAGTTGCAAACCAATTAAACTCC
Reverse Primer: S782_R ACAAGTACAGGCCGGAAATG
Reviews

Customers who bought this product also purchased
FGC11
FGC11
FGC48180
FGC48180
FGC68208
FGC68208
YFS4293977
YFS4293977
FGC68210
FGC68210
YFS4293944
YFS4293944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies