Top » Catalog » SNPs » FGC22262

$18.00

FGC22262
[FGC22262]

FGC22262
hg38 Position: ChrY:12265822..12265822
Ancestral: del
Derived: ins
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC22262v2_F CTGAAGCTCCCCATACCCTAC
Reverse Primer: FGC22262v2_R TGGAACCAGCTTCCACTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies