Top » Catalog » SNPs » FGC5229

$18.00

FGC5229
[FGC5229]

FGC5229
hg38 Position: ChrY:12825792..12825792
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below L858 > Z640 > FGC5230 > FGC5206
Forward Primer: FGC5229_F AGCCAACTGAAAAGCTCTCG
Reverse Primer: FGC5229_R ACGCCTATAATCCCAGCTACC
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
YFS449079
YFS449079
Z16501
Z16501
Y23481
Y23481
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies