Top » Catalog » SNPs » CTS6868

$18.00

CTS6868
[CTS6868]

CTS6868
hg38 Position: ChrY:15046660..15046660
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I1 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS6868_F CCATTTTTGGCTGATTCCAG
Reverse Primer: CTS6868_R GGCACGGTGTCTCAAACTTG
Reviews

Customers who bought this product also purchased
PH497
PH497
FGC28767
FGC28767
YP1081
YP1081
FGC41265
FGC41265
Z140
Z140
Y7397
Y7397
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies