Top » Catalog » SNPs » Y18892

$18.00

Y18892
[Y18892]

Y18892
hg38 Position: ChrY:16782356..16782356
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Below M458 > L1029 > YP263
Forward Primer: Y18892_F GTAATGTATATCACGAAGTCTACTGCG
Reverse Primer: Y18892_R GAGGAAACGCACATGTTCG
Reviews

Customers who bought this product also purchased
YP5478
YP5478
Y2912
Y2912
YP254
YP254
Z282
Z282
Y20359
Y20359
FT168438
FT168438
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies