Top » Catalog » SNPs » YP5253

$18.00

YP5253
[YP5253]

YP5253
hg38 Position: ChrY:9289259..9289259
Ancestral: G
Derived: A
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below M458 > L260 > YP1337
Forward Primer: YP5253_F CTGACTTTATTGCTGCTTACACTCTAG
Reverse Primer: YP5253_R TGTGTGCACCTGCAAGTGA
Reviews

Customers who bought this product also purchased
Z4624
Z4624
YP258
YP258
DYS464
DYS464
Z282
Z282
A19325
A19325
DYS518
DYS518
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies