Top » Catalog » SNPs » YP5253

$18.00

YP5253
[YP5253]

YP5253
hg38 Position: ChrY:9289259..9289259
Ancestral: G
Derived: A
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below M458 > L260 > YP1337
Forward Primer: YP5253_F CTGACTTTATTGCTGCTTACACTCTAG
Reverse Primer: YP5253_R TGTGTGCACCTGCAAGTGA
Reviews

Customers who bought this product also purchased
Y140901
Y140901
L145
L145
Y184194
Y184194
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Y72918
Y72918
PF6155
PF6155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies