Top » Catalog » SNPs » YP5253

$18.00

YP5253
[YP5253]

YP5253
hg38 Position: ChrY:9289259..9289259
Ancestral: G
Derived: A
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below M458 > L260 > YP1337
Forward Primer: YP5253_F CTGACTTTATTGCTGCTTACACTCTAG
Reverse Primer: YP5253_R TGTGTGCACCTGCAAGTGA
Reviews

Customers who bought this product also purchased
Y140901
Y140901
Y17491
Y17491
Y166631
Y166631
L62
L62
FT186708
FT186708
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies