Top » Catalog » SNPs » CTS1460

$18.00

CTS1460
[CTS1460]

CTS1460
hg38 Position: ChrY:7548022..7548022
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: not listed
Comments: Syn. with CTS1460; downstream CTS1267
Forward Primer: CTS1460_F CAAGCCTTTCCCCTAAGAAG
Reverse Primer: CTS1460_R GGAGGCACTGACTACGAACC
Reviews

Customers who bought this product also purchased
Y147485
Y147485
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Y83506
Y83506
ZS81
ZS81
Z1865
Z1865
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies