Top » Catalog » SNPs » CTS1460

$18.00

CTS1460
[CTS1460]

CTS1460
hg38 Position: ChrY:7548022..7548022
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: not listed
Comments: Syn. with CTS1460; downstream CTS1267
Forward Primer: CTS1460_F CAAGCCTTTCCCCTAAGAAG
Reverse Primer: CTS1460_R GGAGGCACTGACTACGAACC
Reviews

Customers who bought this product also purchased
ZS81
ZS81
Z1865
Z1865
FGC11
FGC11
FGC37503
FGC37503
M96
M96
Y147485
Y147485
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies