Top » Catalog » SNPs » CTS7188

$18.00

CTS7188
[CTS7188]

CTS7188
hg38 Position: ChrY:15228838..15228838
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1
Comments: Below Z1828 > CTS1460
Forward Primer: CTS7188_F CAGGAGGAATTTAGCTGAGCAC
Reverse Primer: CTS7188_R GGATTCAGGACAGAGGTTGG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Y83506
Y83506
ZS81
ZS81
Z1865
Z1865
FGC11
FGC11
FGC37503
FGC37503
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies