Top » Catalog » SNPs » Z1842

$18.00

Z1842
[Z1842]

Z1842
hg38 Position: ChrY:18976146..18976146
Ancestral: T
Derived: C
Reference: http://dna-forums.org (B. Schrack 2011)
ISOGG Haplogroup: J1a3a
Comments: Downstream of or equivalent to M267. negative for L136
Forward Primer: Z1842_F CCAGCTCCTGGGTTCAAG
Reverse Primer: Z1842_R TTTAGCTGGTGGGTGAAAATG
Reviews

Customers who bought this product also purchased
FGC11
FGC11
ZS10873
ZS10873
FGC1695
FGC1695
Y147485
Y147485
FGC5
FGC5
Y83506
Y83506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies