Top » Catalog » SNPs » Z1842

$18.00

Z1842
[Z1842]

Z1842
hg38 Position: ChrY:18976146..18976146
Ancestral: T
Derived: C
Reference: http://dna-forums.org (B. Schrack 2011)
ISOGG Haplogroup: J1a3a
Comments: Downstream of or equivalent to M267. negative for L136
Forward Primer: Z1842_F CCAGCTCCTGGGTTCAAG
Reverse Primer: Z1842_R TTTAGCTGGTGGGTGAAAATG
Reviews

Customers who bought this product also purchased
Y147485
Y147485
FGC5
FGC5
Y83506
Y83506
M96
M96
ZS81
ZS81
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies