Top » Catalog » SNPs » Z18445

$18.00

Z18445
[Z18445]

Z18445
hg38 Position: ChrY:20813390..20813390
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples 211325; N63799; downstream CTS7188 aka FGC14059
Forward Primer: Z18445_F GTTTGGGTTCAGTGCAGATG
Reverse Primer: Z18445_R CAAGCCAAAGACATCCTGTG
Reviews

Customers who bought this product also purchased
Z18451
Z18451
FGC1707
FGC1707
ZS9829
ZS9829
CTS1460
CTS1460
FGC5
FGC5
P56
P56
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies