Top » Catalog » SNPs » Z18445

$18.00

Z18445
[Z18445]

Z18445
hg38 Position: ChrY:20813390..20813390
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples 211325; N63799; downstream CTS7188 aka FGC14059
Forward Primer: Z18445_F GTTTGGGTTCAGTGCAGATG
Reverse Primer: Z18445_R CAAGCCAAAGACATCCTGTG
Reviews

Customers who bought this product also purchased
P56
P56
Z18436
Z18436
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS10140
ZS10140
P58
P58
Z18464
Z18464
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies