Top » Catalog » SNPs » Z18445

$18.00

Z18445
[Z18445]

Z18445
hg38 Position: ChrY:20813390..20813390
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples 211325; N63799; downstream CTS7188 aka FGC14059
Forward Primer: Z18445_F GTTTGGGTTCAGTGCAGATG
Reverse Primer: Z18445_R CAAGCCAAAGACATCCTGTG
Reviews

Customers who bought this product also purchased
Z2345
Z2345
ZS7002
ZS7002
L858
L858
Z1828
Z1828
Z18451
Z18451
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies