Top » Catalog » SNPs » Z1865

$18.00

Z1865
[Z1865]

Z1865
hg38 Position: ChrY:14247126..14247126
Ancestral: G
Derived: T
Reference: http://dna-forums.org (B. Schrack 2011)
ISOGG Haplogroup: J1a1b1b1a2
Comments: Approximately equivalent to L147 or P58
Forward Primer: Z1865_F ACCCACAGCATGCTCAAAAC
Reverse Primer: Z1865_R TTCAAACAGTGCCATTACCC
Reviews

Customers who bought this product also purchased
FGC4415
FGC4415
PF4869
PF4869
FGC15940
FGC15940
ZS4313
ZS4313
M96
M96
Y136165
Y136165
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies