Top » Catalog » SNPs » FGC19842

$18.00

FGC19842
[FGC19842]

FGC19842
hg38 Position: ChrY:9237878..9237878
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: M222 > DF85 > S673 > DF97 > FGC19845
Forward Primer: FGC19842_F GGGTTTCAGGATGTTAGCCAC
Reverse Primer: FGC19842_R CTAAGTGTTCCTTGCCCTCC
Reviews

Customers who bought this product also purchased
S588
S588
FGC33214
FGC33214
S659
S659
FGC19845
FGC19845
M222
M222
DF97
DF97
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies