Top » Catalog » SNPs » Z18294

$18.00

Z18294
[Z18294]

Z18294
hg38 Position: ChrY:13043405..13043405
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples N112135; N33162; downstream L862
Forward Primer: Z18294_F GTAGTTGCCATCAGAAAAGGAC
Reverse Primer: Z18294_R TCTGGTTGTTCTGCTATTGAATG
Reviews

Customers who bought this product also purchased
ZS2582
ZS2582
PF5911
PF5911
L862
L862
ZS4313
ZS4313
ZS8438
ZS8438
P58
P58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies