Top » Catalog » SNPs » Z18294

$18.00

Z18294
[Z18294]

Z18294
hg38 Position: ChrY:13043405..13043405
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples N112135; N33162; downstream L862
Forward Primer: Z18294_F GTAGTTGCCATCAGAAAAGGAC
Reverse Primer: Z18294_R TCTGGTTGTTCTGCTATTGAATG
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
PF4845
PF4845
CTS4459
CTS4459
Z1889
Z1889
ZS2582
ZS2582
L862
L862
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies