Top » Catalog » SNPs » B237

$18.00

B237
[B237]

B237
hg38 Position: ChrY:2797261..2797261
Ancestral: T
Derived: A
Reference: Karmin et al. (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: B237_F TCCAGCCACTGAGGGATTAC
Reverse Primer: B237_R AACTAGCCAGGCATCGTAGG
Reviews

Customers who bought this product also purchased
BY198122
BY198122
FGC1707
FGC1707
FGC4415
FGC4415
Z18257
Z18257
FGC19543
FGC19543
Y4348
Y4348
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies