Top » Catalog » SNPs » Z2293

$19.00

Z2293
[Z2293]

Z2293
hg38 Position: ChrY:10140324..10140324
Ancestral: G
Derived: A
Reference: Victar Mas (2012)
ISOGG Haplogroup: not listed
Comments: approximate to Z644
Forward Primer: Z2293_F TTGTGGTGGGTCAAGGTAGC
Reverse Primer: Z2293_R GCGCTGAAAACTCAAAAAGG
Reviews

Customers who bought this product also purchased
ZS1390
ZS1390
FGC54389
FGC54389
ZS1383
ZS1383
FT62222
FT62222
FT213244
FT213244
FT212079
FT212079
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies